CRISPR Guide RNA Designer
Scan for PAMs, score guides, and find the cut site
Paste a target sequence, scan both strands for NGG PAM sites, score every candidate guide against transparent design rules, and visualize the double-strand break.
The takeaway
Cas9 finds the PAM before it ever checks your guide. No PAM, no cut — which is the first and hardest constraint in genome editing.
GC-rich human locus; contains the widely-used EMX1 benchmark site (GTCACCTCCAATGACTAGGG + TGG).
Cas9 nicks both strands at the same position, producing a blunt double-strand break 3 bp upstream of the PAM — between protospacer positions 17 and 18. Coordinates are 1-based on the top strand you supplied. This guide targets the bottom strand, so its protospacer reads 5'→3' right-to-left relative to the sequence above, and its PAM sits to the left of the protospacer footprint.
- +50BaselineEvery candidate starts at 50 and is moved by the rules below.
- +25GC content 55%40–60% is the sweet spot: enough G/C for stable RNA:DNA duplex formation, not so much that the guide sticks to unintended sites.
- +8G at position 20The base immediately 5' of the PAM sits in the seed region. Empirically, a G here is associated with higher cleavage efficiency.
No other 20-mer in this sequence comes within 3 mismatches of the protospacer — the guide is unique within the sequence you supplied.
Be honest about this: the count above searches only the few hundred bases you pasted in. A real off-target assessment aligns the protospacer against the entire 3.1 billion-base genome (with a PAM-aware index such as Cas-OFFinder or CRISPOR), weights mismatches by position — mismatches in the PAM-proximal seed are far more disruptive than distal ones — and is ultimately confirmed empirically with GUIDE-seq or CIRCLE-seq. Treat this panel as a lower bound and a teaching aid, never as clearance to edit.
- The guide finds the target. A 20 nt spacer inside the sgRNA base-pairs with a matching 20 nt protospacer in the genome.
- The PAM licenses the cut. Cas9 only engages if the DNA immediately 3' of the protospacer reads NGG. No PAM, no cut — which is also why the bacterium does not shred its own CRISPR array.
- Cas9 makes a blunt double-strand break between positions 17 and 18 of the protospacer — exactly 3 bp upstream of the PAM.
- The cell repairs the break — and that repair, not the cut, is what edits the genome.
Non-homologous end joining glues the ends back together sloppily, inserting or deleting a few bases. If the indel is not a multiple of 3 the reading frame shifts, a premature stop appears, and the gene is destroyed. Cheap, efficient, imprecise.
If you supply a donor template with homology arms, homology- directed repair copies your sequence into the break — letting you correct a point mutation or knock a gene in. Precise, but only active in dividing cells and far less efficient than NHEJ.
This is a transparent, hand-written heuristic, not a machine-learned model. It is meant to teach you why guides fail. Real design tools (Doench 2016 / Rule Set 2, DeepSpCas9) are trained on thousands of measured cleavage events and will disagree with the numbers here.
- Baseline 50
Every candidate starts in the middle of the scale.
- GC content ±25
40–60% ideal. Below 30% the guide binds too weakly; above 80% it binds so tightly it tolerates mismatches and cuts off-target.
- Poly-T −30
TTTT is the Pol III terminator — the U6 promoter would abort transcription of the sgRNA itself.
- Homopolymers −6 / −15
Runs of 4 (or 5+) identical bases cause synthesis slippage and poor folding.
- Position 20 ±8
G adjacent to the PAM helps; C adjacent to the PAM hurts.
- Hairpins −5 each (max −15)
Self-complementary segments make the sgRNA fold on itself instead of loading into Cas9.