Genetic EngineeringAdvanced~15 min

CRISPR Guide RNA Designer

Scan for PAMs, score guides, and find the cut site

Paste a target sequence, scan both strands for NGG PAM sites, score every candidate guide against transparent design rules, and visualize the double-strand break.

The takeaway

Cas9 finds the PAM before it ever checks your guide. No PAM, no cut — which is the first and hardest constraint in genome editing.

PAM recognitionProtospacer designGC contentOff-target riskBlunt cut siteNHEJ vs HDR
Read the theory: Precision Genome Editing
Target DNA (top strand, 5' → 3')

GC-rich human locus; contains the widely-used EMX1 benchmark site (GTCACCTCCAATGACTAGGG + TGG).

Length
245 bp
GC
70%
Guides found
65
+ / − strand
33 / 32
Excellent / Good
1 / 16
Candidate guides
Cut site — guide -94
Protospacer (- strand)PAM (NGG)Blunt DSB
5'
TGGCCGCGCAGTCACCTCCAATGACTAGGGTGGGCAACCACAAACCCACGA
3'
3'
ACCGGCGCGTCAGTGGAGGTTACTGATCCCACCCGTTGGTGTTTGGGTGCT
5'
Protospacer (5'→3')
TTGCCCACCCTAGTCATTGG
PAM
AGG
Blunt cut
between 97 / 98

Cas9 nicks both strands at the same position, producing a blunt double-strand break 3 bp upstream of the PAM — between protospacer positions 17 and 18. Coordinates are 1-based on the top strand you supplied. This guide targets the bottom strand, so its protospacer reads 5'→3' right-to-left relative to the sequence above, and its PAM sits to the left of the protospacer footprint.

Score breakdown
Excellent83/100
  • +50BaselineEvery candidate starts at 50 and is moved by the rules below.
  • +25GC content 55%40–60% is the sweet spot: enough G/C for stable RNA:DNA duplex formation, not so much that the guide sticks to unintended sites.
  • +8G at position 20The base immediately 5' of the PAM sits in the seed region. Empirically, a G here is associated with higher cleavage efficiency.
Specificity within the target region
Near-matches (≤3 mm)
0
…of those, with an NGG PAM
0

No other 20-mer in this sequence comes within 3 mismatches of the protospacer — the guide is unique within the sequence you supplied.

Be honest about this: the count above searches only the few hundred bases you pasted in. A real off-target assessment aligns the protospacer against the entire 3.1 billion-base genome (with a PAM-aware index such as Cas-OFFinder or CRISPOR), weights mismatches by position — mismatches in the PAM-proximal seed are far more disruptive than distal ones — and is ultimately confirmed empirically with GUIDE-seq or CIRCLE-seq. Treat this panel as a lower bound and a teaching aid, never as clearance to edit.

How CRISPR works
  1. The guide finds the target. A 20 nt spacer inside the sgRNA base-pairs with a matching 20 nt protospacer in the genome.
  2. The PAM licenses the cut. Cas9 only engages if the DNA immediately 3' of the protospacer reads NGG. No PAM, no cut — which is also why the bacterium does not shred its own CRISPR array.
  3. Cas9 makes a blunt double-strand break between positions 17 and 18 of the protospacer — exactly 3 bp upstream of the PAM.
  4. The cell repairs the break — and that repair, not the cut, is what edits the genome.
NHEJ → knockout

Non-homologous end joining glues the ends back together sloppily, inserting or deleting a few bases. If the indel is not a multiple of 3 the reading frame shifts, a premature stop appears, and the gene is destroyed. Cheap, efficient, imprecise.

HDR → precise edit

If you supply a donor template with homology arms, homology- directed repair copies your sequence into the break — letting you correct a point mutation or knock a gene in. Precise, but only active in dividing cells and far less efficient than NHEJ.

The scoring rules

This is a transparent, hand-written heuristic, not a machine-learned model. It is meant to teach you why guides fail. Real design tools (Doench 2016 / Rule Set 2, DeepSpCas9) are trained on thousands of measured cleavage events and will disagree with the numbers here.

  • Baseline 50

    Every candidate starts in the middle of the scale.

  • GC content ±25

    40–60% ideal. Below 30% the guide binds too weakly; above 80% it binds so tightly it tolerates mismatches and cuts off-target.

  • Poly-T −30

    TTTT is the Pol III terminator — the U6 promoter would abort transcription of the sgRNA itself.

  • Homopolymers −6 / −15

    Runs of 4 (or 5+) identical bases cause synthesis slippage and poor folding.

  • Position 20 ±8

    G adjacent to the PAM helps; C adjacent to the PAM hurts.

  • Hairpins −5 each (max −15)

    Self-complementary segments make the sgRNA fold on itself instead of loading into Cas9.