Genetic EngineeringAdvanced~20 min
Molecular Cloning Designer
Get a gene into a vector without wrecking it
Choose restriction enzymes, check sticky-end compatibility, ligate an insert into a plasmid, and screen the colonies you actually produced.
The takeaway
Cut with one enzyme and your vector re-circularizes on itself and your insert goes in backwards. Cut with two, and there is only one way in. That asymmetry is why directional cloning exists.
Restriction enzymesSticky vs blunt endsDirectional cloningLigationAntibiotic selectionBlue/white screening
Read the theory: Synthetic Biology & Genetic CircuitsStep 1 · Choose your insert
The workhorse reporter. Clone it downstream of a promoter and the cells literally glow — the fastest way to know your construct expresses.
Step 1b · Choose the two restriction enzymes
These sites get added to your PCR primers, so the amplified cassette comes out flanked by them. The same two enzymes cut open the vector's polylinker. Grey = the enzyme is a problem for this design.
5′ end of insert (upstream, next to the promoter)
3′ end of insert (downstream)
Polylinker (MCS) · bp 380–435 · inside lacZα
5′ AAGCTTCTGCAGGTCGACCTCGAGCCCGGGGGATCCGGTACCGCGGCCGCGAATTC 3′
HindIII@381PstI@391SalI@393XhoI@399SmaI@407BamHI@411KpnI@421NotI@424EcoRI@431
Why this matters
Insulin, 1978
Genentech chemically synthesised the insulin A and B chains and cloned them into an E. coli expression plasmid using exactly this restriction-and-ligate logic. Humulin was approved in 1982 — the first recombinant drug, and the moment biotech became an industry.Every monoclonal antibody
Heavy- and light-chain variable regions are cloned into expression vectors to be produced in CHO cells. Directional cloning matters enormously: an antibody chain cloned backwards makes nothing at all.CAR-T
A CAR is a single synthetic ORF — scFv + hinge + transmembrane + costimulatory domain + CD3ζ — stitched together and cloned into a lentiviral transfer vector. The construct you built here is the same object, minus the virus.pBioNexus-1 is a teaching vector modelled on the pUC/pBR322 lineage. Enzyme recognition sites and cut positions are real; feature coordinates, insert lengths and the internal-site annotations are defined by this construct file and every number on screen is computed from them.
Starting vector
Plac promoter 290–359 (70 bp, +)IPTG-inducible promoter. Drives transcription of whatever sits downstream — including your insert.
lacZα 366–700 (335 bp, +)α-fragment of β-galactosidase. The polylinker sits inside it: an insert disrupts lacZα, which is what blue/white screening reads out.
ori (ColE1) 1,500–2,088 (589 bp, +)Origin of replication. Without it the plasmid is not copied and is lost as the bacteria divide.
AmpR (bla) 2,600–3,460 (861 bp, −)β-lactamase. Confers ampicillin resistance — the selection marker that lets only plasmid-bearing cells grow on the plate.